ID: 1024316084_1024316089

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1024316084 1024316089
Species Human (GRCh38) Human (GRCh38)
Location 7:48018086-48018108 7:48018119-48018141
Sequence CCCAAGAAGATACTGGGTTGCAC TCTGTAGATTGTGTATAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!