ID: 1024332824_1024332831

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1024332824 1024332831
Species Human (GRCh38) Human (GRCh38)
Location 7:48173359-48173381 7:48173410-48173432
Sequence CCAGCACCCAGAACAGTGCCTGG TTGAATAAGTAAAAGAAGGAAGG
Strand - +
Off-target summary {0: 4, 1: 61, 2: 339, 3: 1023, 4: 2760} {0: 1, 1: 0, 2: 8, 3: 93, 4: 955}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!