ID: 1024355920_1024355927

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1024355920 1024355927
Species Human (GRCh38) Human (GRCh38)
Location 7:48413225-48413247 7:48413249-48413271
Sequence CCCTCCTCTTTCTGCTTCTGTCT GGAGTCTCTGGCCCCATGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 242, 4: 1895} {0: 1, 1: 0, 2: 4, 3: 15, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!