ID: 1024362263_1024362264

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1024362263 1024362264
Species Human (GRCh38) Human (GRCh38)
Location 7:48480471-48480493 7:48480494-48480516
Sequence CCGGTCTGTGGCAGGGCAGAGCA CATCATTGCGCAGCCTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 264} {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!