ID: 1024396813_1024396816

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1024396813 1024396816
Species Human (GRCh38) Human (GRCh38)
Location 7:48879006-48879028 7:48879021-48879043
Sequence CCTACTTCCTGTTACTCACCCAG TCACCCAGCAGGCCCTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 236} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!