ID: 1024433959_1024433961

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1024433959 1024433961
Species Human (GRCh38) Human (GRCh38)
Location 7:49326972-49326994 7:49326988-49327010
Sequence CCAGCCAAAATATCTAATTGACA ATTGACAATTGTAAGACAATTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!