ID: 1024471787_1024471798

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1024471787 1024471798
Species Human (GRCh38) Human (GRCh38)
Location 7:49773926-49773948 7:49773955-49773977
Sequence CCCCAGAGACGCCCTAGCCCGGT GCCAGGCGGAGCGCGCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!