ID: 1024497532_1024497534

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1024497532 1024497534
Species Human (GRCh38) Human (GRCh38)
Location 7:50065461-50065483 7:50065491-50065513
Sequence CCTTGGGCAGGTTGTTTTTCCTA TGTGAAAGCCTTTTCTTATCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 22, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!