ID: 1024497755_1024497758

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1024497755 1024497758
Species Human (GRCh38) Human (GRCh38)
Location 7:50067829-50067851 7:50067874-50067896
Sequence CCTGGATAAGTATGTCACTGGGT AGTTAGAGTTAGAACTGGTGTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 2, 3: 14, 4: 87} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!