ID: 1024500922_1024500925

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1024500922 1024500925
Species Human (GRCh38) Human (GRCh38)
Location 7:50104832-50104854 7:50104870-50104892
Sequence CCAGCTGCATTCTCACTAGCTTC TCTTCTGTCTTCCCTCCCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 59, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!