ID: 1024502775_1024502783

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1024502775 1024502783
Species Human (GRCh38) Human (GRCh38)
Location 7:50130669-50130691 7:50130708-50130730
Sequence CCCACATGTACAGGGTAGCAGGC AGGTGTGGGGAGGCCTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82} {0: 1, 1: 1, 2: 7, 3: 37, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!