ID: 1024537579_1024537589

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1024537579 1024537589
Species Human (GRCh38) Human (GRCh38)
Location 7:50450659-50450681 7:50450710-50450732
Sequence CCTGGGAGAGCAAAGCGTGGCTC TGGCTCACCTGCGCCCACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147} {0: 1, 1: 2, 2: 2, 3: 29, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!