ID: 1024550452_1024550467

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1024550452 1024550467
Species Human (GRCh38) Human (GRCh38)
Location 7:50558758-50558780 7:50558810-50558832
Sequence CCTGTGTCCTCACCATGGCCAGA CTCACTGGGGATGGGGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 308} {0: 1, 1: 0, 2: 10, 3: 95, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!