ID: 1024550459_1024550467

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1024550459 1024550467
Species Human (GRCh38) Human (GRCh38)
Location 7:50558788-50558810 7:50558810-50558832
Sequence CCACAGGACTCTAAACAGGGCTC CTCACTGGGGATGGGGAAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 95, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!