ID: 1024551218_1024551229

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1024551218 1024551229
Species Human (GRCh38) Human (GRCh38)
Location 7:50564020-50564042 7:50564055-50564077
Sequence CCCCTTTCCTGGAGACCAGGGTG GGGGTGGCACTGTAGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 0, 3: 39, 4: 308} {0: 1, 1: 0, 2: 4, 3: 32, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!