ID: 1024555434_1024555442

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1024555434 1024555442
Species Human (GRCh38) Human (GRCh38)
Location 7:50599510-50599532 7:50599556-50599578
Sequence CCTGAATCAATCCCATTATCTGC CAGCAGCCTAAGGCGGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 314} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!