ID: 1024566091_1024566103

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1024566091 1024566103
Species Human (GRCh38) Human (GRCh38)
Location 7:50682099-50682121 7:50682146-50682168
Sequence CCACCTTGGGAACCAAGATATTG GAATCCAGAGACTCTTGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118} {0: 1, 1: 0, 2: 0, 3: 17, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!