ID: 1024573171_1024573178

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1024573171 1024573178
Species Human (GRCh38) Human (GRCh38)
Location 7:50742424-50742446 7:50742457-50742479
Sequence CCATGCTCTTAACCAGGATCCTA GGTTTTCAAATGATGGTCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 62, 4: 386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!