ID: 1024621861_1024621864

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1024621861 1024621864
Species Human (GRCh38) Human (GRCh38)
Location 7:51166517-51166539 7:51166551-51166573
Sequence CCAAACATTTAAACAAGAACTAA TTCAAACTATTCCAAAAAACAGG
Strand - +
Off-target summary {0: 5, 1: 329, 2: 754, 3: 1241, 4: 2043} {0: 1, 1: 5, 2: 23, 3: 93, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!