ID: 1024664993_1024665004

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1024664993 1024665004
Species Human (GRCh38) Human (GRCh38)
Location 7:51537073-51537095 7:51537119-51537141
Sequence CCACCCTGCTTCTGCTTGCCCTC CCAGTTCCAATGAGATGAACCGG
Strand - +
Off-target summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!