ID: 1024670127_1024670131

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1024670127 1024670131
Species Human (GRCh38) Human (GRCh38)
Location 7:51586565-51586587 7:51586617-51586639
Sequence CCTCTAAGTTTGCTGTTTAACAT TTCTCTGGGTTCTTTTGTTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!