ID: 1024703977_1024703981

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1024703977 1024703981
Species Human (GRCh38) Human (GRCh38)
Location 7:51938037-51938059 7:51938053-51938075
Sequence CCTTGAACCTGTGTCCTCTGGGA TCTGGGATGAGCCTGGATCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 37, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!