ID: 1024704075_1024704089

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1024704075 1024704089
Species Human (GRCh38) Human (GRCh38)
Location 7:51938474-51938496 7:51938526-51938548
Sequence CCTGGGTCTTCCAAAGAATGAGT CTGGAGACTGGCCTGGACTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 91, 4: 3722}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!