ID: 1024704082_1024704089

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1024704082 1024704089
Species Human (GRCh38) Human (GRCh38)
Location 7:51938506-51938528 7:51938526-51938548
Sequence CCAGCCTAAATCCTGGAGTCCTG CTGGAGACTGGCCTGGACTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!