ID: 1024704084_1024704091

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1024704084 1024704091
Species Human (GRCh38) Human (GRCh38)
Location 7:51938510-51938532 7:51938534-51938556
Sequence CCTAAATCCTGGAGTCCTGGAGA TGGCCTGGACTCTGGGCTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 46, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!