ID: 1024738230_1024738238

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1024738230 1024738238
Species Human (GRCh38) Human (GRCh38)
Location 7:52328523-52328545 7:52328542-52328564
Sequence CCCCTCCCCCAGCCTCACTGCCT GCCTCCTTGCAGTTTGATCTTGG
Strand - +
Off-target summary No data {0: 2, 1: 61, 2: 83, 3: 88, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!