ID: 1024757298_1024757306

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1024757298 1024757306
Species Human (GRCh38) Human (GRCh38)
Location 7:52549952-52549974 7:52550005-52550027
Sequence CCAGCTTTGACCCTGGACAGCAG AGAGGAGACAGCAGAGAGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 101, 4: 881}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!