ID: 1024761942_1024761947

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1024761942 1024761947
Species Human (GRCh38) Human (GRCh38)
Location 7:52609366-52609388 7:52609400-52609422
Sequence CCAATGCCTCGGTGTGCACACTG GGCTCCCTGCCATGCCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!