ID: 1024778408_1024778411

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1024778408 1024778411
Species Human (GRCh38) Human (GRCh38)
Location 7:52816383-52816405 7:52816408-52816430
Sequence CCTGGTACAGGCTTGCCAACCTC TCCCACAGCACACCCTGAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 33, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!