ID: 1024797555_1024797561

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1024797555 1024797561
Species Human (GRCh38) Human (GRCh38)
Location 7:53036581-53036603 7:53036626-53036648
Sequence CCACCTCCGGAGACACAAGCCCA TCCTTGCTCTACCTCAACGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 26, 4: 150} {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!