ID: 1024866202_1024866215

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1024866202 1024866215
Species Human (GRCh38) Human (GRCh38)
Location 7:53907138-53907160 7:53907188-53907210
Sequence CCAGCCACCCCGTCATTGCCCAA GCAGAGATGGATGTTATGCATGG
Strand - +
Off-target summary {0: 2, 1: 8, 2: 6, 3: 27, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!