ID: 1024884341_1024884344

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1024884341 1024884344
Species Human (GRCh38) Human (GRCh38)
Location 7:54124644-54124666 7:54124679-54124701
Sequence CCCAGTAATAGGCAAAGAACTGT GAGTAGCTATCTAAAGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 32, 3: 224, 4: 374} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!