ID: 1024887617_1024887621

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1024887617 1024887621
Species Human (GRCh38) Human (GRCh38)
Location 7:54162215-54162237 7:54162237-54162259
Sequence CCCTTACAATTTCATGATTCTGG GTTTCCTTGGATTTAAAACTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!