ID: 1024895418_1024895421

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1024895418 1024895421
Species Human (GRCh38) Human (GRCh38)
Location 7:54255455-54255477 7:54255494-54255516
Sequence CCATCCTGGATATTTATATTCAT ACTATCTGACCTTTTGTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 401} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!