ID: 1024919764_1024919770

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1024919764 1024919770
Species Human (GRCh38) Human (GRCh38)
Location 7:54544897-54544919 7:54544918-54544940
Sequence CCGGTTCTGTGGAAGCGAGTGAC ACCCCCAGGGCTTCTAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96} {0: 1, 1: 0, 2: 1, 3: 11, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!