ID: 1024971473_1024971476

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1024971473 1024971476
Species Human (GRCh38) Human (GRCh38)
Location 7:55075296-55075318 7:55075319-55075341
Sequence CCGGTGGCCACTTTTCATTCACT CTGAACCCTTCTTTGTATGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!