ID: 1024973120_1024973125

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1024973120 1024973125
Species Human (GRCh38) Human (GRCh38)
Location 7:55088608-55088630 7:55088637-55088659
Sequence CCTCTGGGCATGCGACCTTTCCC TGGCTTTCCCTGTGATTATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118} {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!