ID: 1024987122_1024987126

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1024987122 1024987126
Species Human (GRCh38) Human (GRCh38)
Location 7:55205131-55205153 7:55205148-55205170
Sequence CCGAGGCTCCTGCTCCCTGTCAT TGTCATAAGTCTCCTTGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 365} {0: 1, 1: 0, 2: 2, 3: 4, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!