ID: 1024995183_1024995189

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1024995183 1024995189
Species Human (GRCh38) Human (GRCh38)
Location 7:55268756-55268778 7:55268776-55268798
Sequence CCCTCCAGGAGAGGCAGGAGGGC GGCCAGAGTCAGAGAAGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 108, 4: 761}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!