ID: 1025022246_1025022263

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1025022246 1025022263
Species Human (GRCh38) Human (GRCh38)
Location 7:55488962-55488984 7:55489014-55489036
Sequence CCTCCTCTCAGTCCCCACGCCCC CTGAGCAGACAGCTGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 814} {0: 1, 1: 0, 2: 1, 3: 40, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!