|
Left Crispr |
Right Crispr |
| Crispr ID |
1025025358 |
1025025369 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:55512300-55512322
|
7:55512340-55512362
|
| Sequence |
CCTGTAATCCCAGCTACCCAGGA |
CGCCTGGACCTGGAAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1119, 1: 56965, 2: 146216, 3: 233957, 4: 202134} |
{0: 1, 1: 14, 2: 574, 3: 10758, 4: 52176} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|