|
Left Crispr |
Right Crispr |
| Crispr ID |
1025025363 |
1025025369 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:55512316-55512338
|
7:55512340-55512362
|
| Sequence |
CCCAGGAGGCTGAGACAGGAGAG |
CGCCTGGACCTGGAAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 117, 2: 1969, 3: 6409, 4: 7413} |
{0: 1, 1: 14, 2: 574, 3: 10758, 4: 52176} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|