ID: 1025028533_1025028541

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1025028533 1025028541
Species Human (GRCh38) Human (GRCh38)
Location 7:55537214-55537236 7:55537264-55537286
Sequence CCTTCAGCTGAACACACATATTT CAACATCTGGGAAGCCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 267} {0: 1, 1: 0, 2: 1, 3: 47, 4: 418}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!