ID: 1025069676_1025069683

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1025069676 1025069683
Species Human (GRCh38) Human (GRCh38)
Location 7:55887590-55887612 7:55887603-55887625
Sequence CCGGGTCCACCGCGGCGGCGGCG GGCGGCGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 274} {0: 1025, 1: 1397, 2: 2293, 3: 4170, 4: 7329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!