ID: 1025078740_1025078763

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1025078740 1025078763
Species Human (GRCh38) Human (GRCh38)
Location 7:55964692-55964714 7:55964743-55964765
Sequence CCAGGCTCCGGTGAGCAGCGCCG CGCCGCGAGGCGGAGGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 134} {0: 1, 1: 0, 2: 2, 3: 29, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!