ID: 1025093712_1025093718

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1025093712 1025093718
Species Human (GRCh38) Human (GRCh38)
Location 7:56082185-56082207 7:56082216-56082238
Sequence CCGGGTGGTCCTCATTCATGGAG AATCTCAGGGGCCAGGTAACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 124} {0: 1, 1: 1, 2: 0, 3: 10, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!