ID: 1025168633_1025168638

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1025168633 1025168638
Species Human (GRCh38) Human (GRCh38)
Location 7:56735925-56735947 7:56735953-56735975
Sequence CCCGGCCACTTTTGTGTTTTTTA TGAGAAGGAGTCGCCGAGGCTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 81, 3: 1401, 4: 13595} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!