ID: 1025176318_1025176326

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1025176318 1025176326
Species Human (GRCh38) Human (GRCh38)
Location 7:56804152-56804174 7:56804181-56804203
Sequence CCAGCTCCGGCCTCCCGGTGGCC GGTGCAACGCGTCCTCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 104, 3: 328, 4: 647} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!