ID: 1025200912_1025200918

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1025200912 1025200918
Species Human (GRCh38) Human (GRCh38)
Location 7:56961116-56961138 7:56961138-56961160
Sequence CCTGATGAGGTGGGGATGCGTCC CCAAGGTCGAGGCTCCTTGAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 8, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!