ID: 1025200912_1025200919

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1025200912 1025200919
Species Human (GRCh38) Human (GRCh38)
Location 7:56961116-56961138 7:56961139-56961161
Sequence CCTGATGAGGTGGGGATGCGTCC CAAGGTCGAGGCTCCTTGAGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 8, 4: 72} {0: 3, 1: 0, 2: 0, 3: 8, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!